pcmv megfp rac1 (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
pcmv megfp rac1
Pcmv Megfp Rac1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+megfp+rac1/mEGFP-Rac1+(Plasmid+%2383950)/pmc08285108-346-41-42
Average 92 stars, based on 2 article reviews
Pcmv Megfp Rac1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+megfp+rac1/mEGFP-Rac1+(Plasmid+%2383950)/pmc08285108-346-41-42
Average 92 stars, based on 2 article reviews
pcmv megfp rac1 - by Bioz Stars,
2026-11
92/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). pCMV-mEGFP-Rac1 (Addgene plasmid #83950) and pCAG-mCherry-PBD2-mCherry (Addgene plasmid #83951) were a gift from Ryohei Yasuda. pAAV-hSyn-BioID2-HA, pAAV-hSyn-BioID2-Linker-BioID2-HA, pCAG-GFP, pAAV-hSyn-Cre, pBetaActin-tdTomato, and pEGFP-mCherry-GPI were previously generated in the Soderling lab. pAAV-hSyn-BioID2-Linker-Synapsin1a-HA was generated by PCR of Synapsin1a from pCMVEGFP-Synapsin1a (primers FWD: 5’GGTGTCTAAGGAATTCAACTACCTGCGGCGCCGC3’ and REV: 5’AAGGGTAAGCGCTAGCGTCGGAGAAGAGGCTGGC3’) and insertion into the EcoRI/NheI sites of pAAV-hSyn-BioID2-Linker-BioID2-HA using In-Fusion cloning (TaKaRa). pAAV-hSyn-mCherry-LinkerSynapsin1a was generated by a two-step process to remove the HA tag. .. DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. Generated:Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). pCMV-mEGFP-Rac1 (Addgene plasmid #83950) and pCAG-mCherry-PBD2-mCherry (Addgene plasmid #83951) were a gift from Ryohei Yasuda. pAAV-hSyn-BioID2-HA, pAAV-hSyn-BioID2-Linker-BioID2-HA, pCAG-GFP, pAAV-hSyn-Cre, pBetaActin-tdTomato, and pEGFP-mCherry-GPI were previously generated in the Soderling lab. pAAV-hSyn-BioID2-Linker-Synapsin1a-HA was generated by PCR of Synapsin1a from pCMVEGFP-Synapsin1a (primers FWD: 5’GGTGTCTAAGGAATTCAACTACCTGCGGCGCCGC3’ and REV: 5’AAGGGTAAGCGCTAGCGTCGGAGAAGAGGCTGGC3’) and insertion into the EcoRI/NheI sites of pAAV-hSyn-BioID2-Linker-BioID2-HA using In-Fusion cloning (TaKaRa). pAAV-hSyn-mCherry-LinkerSynapsin1a was generated by a two-step process to remove the HA tag. .. DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. Polymerase Chain Reaction:Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). pCMV-mEGFP-Rac1 (Addgene plasmid #83950) and pCAG-mCherry-PBD2-mCherry (Addgene plasmid #83951) were a gift from Ryohei Yasuda. pAAV-hSyn-BioID2-HA, pAAV-hSyn-BioID2-Linker-BioID2-HA, pCAG-GFP, pAAV-hSyn-Cre, pBetaActin-tdTomato, and pEGFP-mCherry-GPI were previously generated in the Soderling lab. pAAV-hSyn-BioID2-Linker-Synapsin1a-HA was generated by PCR of Synapsin1a from pCMVEGFP-Synapsin1a (primers FWD: 5’GGTGTCTAAGGAATTCAACTACCTGCGGCGCCGC3’ and REV: 5’AAGGGTAAGCGCTAGCGTCGGAGAAGAGGCTGGC3’) and insertion into the EcoRI/NheI sites of pAAV-hSyn-BioID2-Linker-BioID2-HA using In-Fusion cloning (TaKaRa). pAAV-hSyn-mCherry-LinkerSynapsin1a was generated by a two-step process to remove the HA tag. .. DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. Cloning:Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). pCMV-mEGFP-Rac1 (Addgene plasmid #83950) and pCAG-mCherry-PBD2-mCherry (Addgene plasmid #83951) were a gift from Ryohei Yasuda. pAAV-hSyn-BioID2-HA, pAAV-hSyn-BioID2-Linker-BioID2-HA, pCAG-GFP, pAAV-hSyn-Cre, pBetaActin-tdTomato, and pEGFP-mCherry-GPI were previously generated in the Soderling lab. pAAV-hSyn-BioID2-Linker-Synapsin1a-HA was generated by PCR of Synapsin1a from pCMVEGFP-Synapsin1a (primers FWD: 5’GGTGTCTAAGGAATTCAACTACCTGCGGCGCCGC3’ and REV: 5’AAGGGTAAGCGCTAGCGTCGGAGAAGAGGCTGGC3’) and insertion into the EcoRI/NheI sites of pAAV-hSyn-BioID2-Linker-BioID2-HA using In-Fusion cloning (TaKaRa). pAAV-hSyn-mCherry-LinkerSynapsin1a was generated by a two-step process to remove the HA tag. .. DOI: https://doi.org/10.7554/eLife.63756 24 of 44 Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAVhSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. Plasmids pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. pAAV-hSyn- CaMPARI2 was a gift from Eric Schreiter (Addgene plasmid #101060). Article Title: Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Article Snippet: .. pCMV-EGFP-Synapsin1a (rat) was generously provided by George Augustine. pAAV-hSyn-hChR2 (H134R)-EYFP (Addgene plasmid #26973) was a gift from Karl Deisseroth. pCAG-ChrimsonR-tdTomato (Addgene plasmid #59169) was a gift from Edward Boyden. |